ID: 994016734_994016738

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 994016734 994016738
Species Human (GRCh38) Human (GRCh38)
Location 5:94975407-94975429 5:94975429-94975451
Sequence CCATGCACTGAGGAAAGGCCTTC CTGAGCACACAGCAGGAAGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 200} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!