ID: 994080049_994080055

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 994080049 994080055
Species Human (GRCh38) Human (GRCh38)
Location 5:95698483-95698505 5:95698513-95698535
Sequence CCGGAAGGCTTCCAAGAGACAAA GGGTTATTTGCCACTCCTAAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 214} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!