|
Left Crispr |
Right Crispr |
Crispr ID |
994102399 |
994102403 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
5:95908295-95908317
|
5:95908309-95908331
|
Sequence |
CCCCTTTCACAGATGAGAAAACT |
GAGAAAACTGAGGCTTTTAATGG |
Strand |
- |
+ |
Off-target summary |
{0: 5, 1: 105, 2: 950, 3: 4027, 4: 10180} |
{0: 1, 1: 2, 2: 41, 3: 325, 4: 1772} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|