ID: 994102399_994102408

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 994102399 994102408
Species Human (GRCh38) Human (GRCh38)
Location 5:95908295-95908317 5:95908348-95908370
Sequence CCCCTTTCACAGATGAGAAAACT AAAATCCTCACTTAGCATTTGGG
Strand - +
Off-target summary {0: 5, 1: 105, 2: 950, 3: 4027, 4: 10180} {0: 1, 1: 0, 2: 2, 3: 16, 4: 237}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!