ID: 994102401_994102407

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 994102401 994102407
Species Human (GRCh38) Human (GRCh38)
Location 5:95908297-95908319 5:95908347-95908369
Sequence CCTTTCACAGATGAGAAAACTGA TAAAATCCTCACTTAGCATTTGG
Strand - +
Off-target summary {0: 9, 1: 90, 2: 457, 3: 1295, 4: 2689} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!