ID: 994320793_994320802

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 994320793 994320802
Species Human (GRCh38) Human (GRCh38)
Location 5:98392430-98392452 5:98392461-98392483
Sequence CCTCCTGCTGGGCCGGCTGCGGG CAGCTCGGACAGCTTGCGGTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 26, 4: 340} {0: 1, 1: 0, 2: 11, 3: 24, 4: 66}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!