ID: 994320796_994320802

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 994320796 994320802
Species Human (GRCh38) Human (GRCh38)
Location 5:98392433-98392455 5:98392461-98392483
Sequence CCTGCTGGGCCGGCTGCGGGGCA CAGCTCGGACAGCTTGCGGTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 37, 4: 520} {0: 1, 1: 0, 2: 11, 3: 24, 4: 66}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!