ID: 994406555_994406558

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 994406555 994406558
Species Human (GRCh38) Human (GRCh38)
Location 5:99352615-99352637 5:99352637-99352659
Sequence CCTGGAAAAACCACCATAAGTTT TTCACTCCAGTCCACAGAACTGG
Strand - +
Off-target summary No data {0: 2, 1: 3, 2: 10, 3: 47, 4: 209}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!