ID: 994468175_994468181

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 994468175 994468181
Species Human (GRCh38) Human (GRCh38)
Location 5:100165584-100165606 5:100165620-100165642
Sequence CCTAGAAAATATGCAAGATTAGG ACAGGGCCTCTGCAGTGAAAAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 24, 4: 231}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!