ID: 994601597_994601598

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 994601597 994601598
Species Human (GRCh38) Human (GRCh38)
Location 5:101912323-101912345 5:101912341-101912363
Sequence CCTAATTAGCTGTATTCTTAGAT TAGATATTTTATTCTTTTTGAGG
Strand - +
Off-target summary No data {0: 83, 1: 705, 2: 999, 3: 954, 4: 2263}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!