ID: 994710099_994710106

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 994710099 994710106
Species Human (GRCh38) Human (GRCh38)
Location 5:103256157-103256179 5:103256187-103256209
Sequence CCCATGGCAGGTGTATCAGACTT GCAAGGCACTGGAAGGAGATTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 92} {0: 1, 1: 0, 2: 3, 3: 47, 4: 389}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!