ID: 994710105_994710110

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 994710105 994710110
Species Human (GRCh38) Human (GRCh38)
Location 5:103256182-103256204 5:103256200-103256222
Sequence CCAATGCAAGGCACTGGAAGGAG AGGAGATTGGAGGGCAGGAGAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!