ID: 995146659_995146667

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 995146659 995146667
Species Human (GRCh38) Human (GRCh38)
Location 5:108794708-108794730 5:108794753-108794775
Sequence CCACTCTCTCCTGCCATGTAAGA CACACATGTGGGATCTCCATTGG
Strand - +
Off-target summary {0: 1, 1: 5, 2: 66, 3: 511, 4: 1688} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!