ID: 995211960_995211966

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 995211960 995211966
Species Human (GRCh38) Human (GRCh38)
Location 5:109550932-109550954 5:109550973-109550995
Sequence CCTAGAGACTTGTTGAATGGCTT CCATATGGGCAATAAAGTCCAGG
Strand - +
Off-target summary {0: 1428, 1: 1886, 2: 1423, 3: 807, 4: 580} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!