ID: 995243974_995243978

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 995243974 995243978
Species Human (GRCh38) Human (GRCh38)
Location 5:109916857-109916879 5:109916909-109916931
Sequence CCAAGATAATGACTAAATTTAAT CCTGACAGCCATGAGGCTGCTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!