ID: 995520975_995520980

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 995520975 995520980
Species Human (GRCh38) Human (GRCh38)
Location 5:113005008-113005030 5:113005033-113005055
Sequence CCAGCTACTCTAGATAGAGCCCG GCAGGAGAATTGCTTGAACTCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 35} {0: 2253, 1: 36965, 2: 88210, 3: 154472, 4: 99545}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!