ID: 995530209_995530213

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 995530209 995530213
Species Human (GRCh38) Human (GRCh38)
Location 5:113085006-113085028 5:113085024-113085046
Sequence CCTTGCAGCTCCTGCATAGAAGG GAAGGCCTGCGTAAGGTCCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 170} {0: 1, 1: 0, 2: 0, 3: 5, 4: 88}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!