ID: 995530209_995530223

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 995530209 995530223
Species Human (GRCh38) Human (GRCh38)
Location 5:113085006-113085028 5:113085054-113085076
Sequence CCTTGCAGCTCCTGCATAGAAGG CCTTGTGCTGTCTCAGCTAAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 170} {0: 1, 1: 0, 2: 0, 3: 13, 4: 168}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!