ID: 995608011_995608014

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 995608011 995608014
Species Human (GRCh38) Human (GRCh38)
Location 5:113879222-113879244 5:113879257-113879279
Sequence CCTGTGGAACTGTGAGCCAATTA ATATTAATTACCCAATAAATTGG
Strand - +
Off-target summary {0: 231, 1: 977, 2: 2316, 3: 3783, 4: 4792} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!