ID: 995633537_995633542

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 995633537 995633542
Species Human (GRCh38) Human (GRCh38)
Location 5:114160155-114160177 5:114160197-114160219
Sequence CCCTCTACATACTGCTTAGAATG TGTTGTGTCTTTGTTCTCATTGG
Strand - +
Off-target summary No data {0: 2553, 1: 4771, 2: 3165, 3: 1505, 4: 1050}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!