|
Left Crispr |
Right Crispr |
Crispr ID |
995633537 |
995633542 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
5:114160155-114160177
|
5:114160197-114160219
|
Sequence |
CCCTCTACATACTGCTTAGAATG |
TGTTGTGTCTTTGTTCTCATTGG |
Strand |
- |
+ |
Off-target summary |
No data |
{0: 2553, 1: 4771, 2: 3165, 3: 1505, 4: 1050} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|