ID: 995690056_995690058

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 995690056 995690058
Species Human (GRCh38) Human (GRCh38)
Location 5:114815648-114815670 5:114815672-114815694
Sequence CCAGACTTTGGTATCAGAAAGAC CTGGCCTCATAAAATGAGTTAGG
Strand - +
Off-target summary No data {0: 8575, 1: 5102, 2: 3543, 3: 3755, 4: 3681}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!