ID: 995690056_995690061

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 995690056 995690061
Species Human (GRCh38) Human (GRCh38)
Location 5:114815648-114815670 5:114815700-114815722
Sequence CCAGACTTTGGTATCAGAAAGAC TTCCCTCTTTTTCTATTGATCGG
Strand - +
Off-target summary No data {0: 6681, 1: 3341, 2: 1749, 3: 1160, 4: 1622}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!