ID: 995715932_995715941 |
View in Genome Browser |
Spacer: 24 |
Left Crispr | Right Crispr | |
---|---|---|
Crispr ID | 995715932 | 995715941 |
Species | Human (GRCh38) | Human (GRCh38) |
Location | 5:115081993-115082015 | 5:115082040-115082062 |
Sequence | CCTTCCTTCAATTTCCAGAATCA | CAGTCTGAGCTGCTGGAGCTAGG |
Strand | - | + |
Off-target summary | {0: 13, 1: 20, 2: 30, 3: 61, 4: 400} | No data |
Status | Not started |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer | Left Crispr | Right Crispr | ||||||
---|---|---|---|---|---|---|---|---|
Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
No off target data available for this pair! |