ID: 995715939_995715941

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 995715939 995715941
Species Human (GRCh38) Human (GRCh38)
Location 5:115082025-115082047 5:115082040-115082062
Sequence CCTGTGCTGTAATGGCAGTCTGA CAGTCTGAGCTGCTGGAGCTAGG
Strand - +
Off-target summary {0: 6, 1: 13, 2: 12, 3: 24, 4: 109} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!