ID: 996021534_996021540

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 996021534 996021540
Species Human (GRCh38) Human (GRCh38)
Location 5:118595948-118595970 5:118595971-118595993
Sequence CCATGTTCCCTGTCTTCACACAG CCTCTCACAGTGGTGTGGCCTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 19, 4: 243}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!