ID: 996072570_996072574

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 996072570 996072574
Species Human (GRCh38) Human (GRCh38)
Location 5:119150274-119150296 5:119150314-119150336
Sequence CCTGAGCATGCTCAGGTTCTTTC CTAGTTTACCAGGACTCAGCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 154} {0: 1, 1: 0, 2: 1, 3: 4, 4: 73}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!