ID: 996346955_996346956

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 996346955 996346956
Species Human (GRCh38) Human (GRCh38)
Location 5:122497954-122497976 5:122497974-122497996
Sequence CCAAGTCACAGAGTCTGTGAGTT GTTTGTCACAGTAAGTGATGAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 8, 4: 153}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!