ID: 996435739_996435747

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 996435739 996435747
Species Human (GRCh38) Human (GRCh38)
Location 5:123430863-123430885 5:123430889-123430911
Sequence CCTCCTCGACGAGCGCCACCCCC TCCACGGCGCCCAGTCCCATCGG
Strand - +
Off-target summary No data {0: 3, 1: 7, 2: 4, 3: 6, 4: 130}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!