ID: 996549118_996549130

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 996549118 996549130
Species Human (GRCh38) Human (GRCh38)
Location 5:124711822-124711844 5:124711870-124711892
Sequence CCAGGCCAGGCTAAGAATCTGGG CACTGAGGATTTTAAAGTAGGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 3, 3: 34, 4: 271}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!