ID: 996694582_996694584

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 996694582 996694584
Species Human (GRCh38) Human (GRCh38)
Location 5:126379786-126379808 5:126379832-126379854
Sequence CCTTGTACATTCTGGATATCAGT GAAGATTTTCTCCCACTCTGTGG
Strand - +
Off-target summary {0: 3, 1: 43, 2: 989, 3: 3864, 4: 4702} {0: 654, 1: 876, 2: 840, 3: 2663, 4: 3826}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!