ID: 996694582_996694585

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 996694582 996694585
Species Human (GRCh38) Human (GRCh38)
Location 5:126379786-126379808 5:126379833-126379855
Sequence CCTTGTACATTCTGGATATCAGT AAGATTTTCTCCCACTCTGTGGG
Strand - +
Off-target summary No data {0: 726, 1: 1318, 2: 13033, 3: 17048, 4: 10056}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!