ID: 996769726_996769745

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 996769726 996769745
Species Human (GRCh38) Human (GRCh38)
Location 5:127073481-127073503 5:127073533-127073555
Sequence CCGCCCTGCGCCGGGCACTTCCG CCCGCACTTCCGCCCCACGCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 145} {0: 1, 1: 0, 2: 1, 3: 10, 4: 111}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!