ID: 996769727_996769732

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 996769727 996769732
Species Human (GRCh38) Human (GRCh38)
Location 5:127073484-127073506 5:127073502-127073524
Sequence CCCTGCGCCGGGCACTTCCGCCC CGCCCGCACCCACCAGGCGCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 96} {0: 1, 1: 0, 2: 0, 3: 20, 4: 208}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!