ID: 996769736_996769752

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 996769736 996769752
Species Human (GRCh38) Human (GRCh38)
Location 5:127073510-127073532 5:127073549-127073571
Sequence CCCACCAGGCGCCGGCCCCAGGC ACGCCGGCAGCACTGCCGCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 19, 4: 306} {0: 1, 1: 0, 2: 0, 3: 1, 4: 46}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!