ID: 997050450_997050453

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 997050450 997050453
Species Human (GRCh38) Human (GRCh38)
Location 5:130373869-130373891 5:130373897-130373919
Sequence CCGCTAAAATTCATATATTGAAA TCTCCAATAGTGATGGTATTAGG
Strand - +
Off-target summary {0: 6, 1: 158, 2: 791, 3: 2255, 4: 4237} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!