ID: 997302191_997302201

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 997302191 997302201
Species Human (GRCh38) Human (GRCh38)
Location 5:132814042-132814064 5:132814071-132814093
Sequence CCACAGGACACCCCGGGGGGGCC CGAGCCCGCTCAGCCGCCCGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 223} {0: 1, 1: 0, 2: 1, 3: 9, 4: 95}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!