ID: 997679346_997679356

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 997679346 997679356
Species Human (GRCh38) Human (GRCh38)
Location 5:135738399-135738421 5:135738425-135738447
Sequence CCTCCACACCAGGACCCCTGGGC TGTTTGCAGCTGATGGGAAGAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!