ID: 997763655_997763659

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 997763655 997763659
Species Human (GRCh38) Human (GRCh38)
Location 5:136476415-136476437 5:136476433-136476455
Sequence CCCTCTTTCTCTATCTTATGGAA TGGAATAGTGCCAATGGGATTGG
Strand - +
Off-target summary {0: 21, 1: 337, 2: 543, 3: 550, 4: 2106} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!