ID: 997769314_997769318

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 997769314 997769318
Species Human (GRCh38) Human (GRCh38)
Location 5:136540090-136540112 5:136540141-136540163
Sequence CCATCCGATTGAATAATTAGTAC CACTCAGATGTACCTACAATCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 42} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!