ID: 997876518_997876521

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 997876518 997876521
Species Human (GRCh38) Human (GRCh38)
Location 5:137553020-137553042 5:137553054-137553076
Sequence CCAACTCCATCCAGATTGTTGCA AATTATTTTATTCCTTTTTATGG
Strand - +
Off-target summary {0: 1, 1: 12, 2: 161, 3: 938, 4: 4013} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!