ID: 998037396_998037398

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 998037396 998037398
Species Human (GRCh38) Human (GRCh38)
Location 5:138928578-138928600 5:138928591-138928613
Sequence CCCAGGACAGTTCTCATCTTTGT TCATCTTTGTCTTAAAATGCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 19, 4: 226} {0: 1, 1: 0, 2: 1, 3: 32, 4: 273}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!