ID: 998068284_998068290

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 998068284 998068290
Species Human (GRCh38) Human (GRCh38)
Location 5:139176646-139176668 5:139176686-139176708
Sequence CCTTCTTACTGGGTCCTCACATG CTCCTCGGGCCTCTTTTATAAGG
Strand - +
Off-target summary {0: 1, 1: 58, 2: 666, 3: 1875, 4: 3104} {0: 1, 1: 3, 2: 41, 3: 237, 4: 833}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!