ID: 998116714_998116727

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 998116714 998116727
Species Human (GRCh38) Human (GRCh38)
Location 5:139543425-139543447 5:139543475-139543497
Sequence CCGTGGGCCCAGCTTCCCTCTAT AGTAGGCGGGCTGCAGAGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 30, 4: 327} {0: 1, 1: 0, 2: 0, 3: 14, 4: 246}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!