ID: 998130737_998130739

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 998130737 998130739
Species Human (GRCh38) Human (GRCh38)
Location 5:139649937-139649959 5:139649958-139649980
Sequence CCGGCGGGGAGCGCGGGGTGCGC GCCTGGCTTTGTTTATTTGTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 20, 4: 215} {0: 1, 1: 0, 2: 1, 3: 34, 4: 329}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!