ID: 998285624_998285632

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 998285624 998285632
Species Human (GRCh38) Human (GRCh38)
Location 5:140857732-140857754 5:140857764-140857786
Sequence CCCGCGCTGCTGGCGTCTCCCGC GGGCGGTGCAGTCAGTGAGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 30, 4: 173} {0: 1, 1: 0, 2: 2, 3: 16, 4: 203}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!