ID: 998322771_998322779

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 998322771 998322779
Species Human (GRCh38) Human (GRCh38)
Location 5:141247609-141247631 5:141247630-141247652
Sequence CCCGGCCCAAGCCCAGGCCGACT CTCGCTTACCGTCTACCTGGTGG
Strand - +
Off-target summary {0: 2, 1: 7, 2: 5, 3: 67, 4: 345} {0: 1, 1: 2, 2: 15, 3: 1, 4: 50}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!