ID: 998323082_998323084

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 998323082 998323084
Species Human (GRCh38) Human (GRCh38)
Location 5:141250943-141250965 5:141250970-141250992
Sequence CCTCAATTTGCATTAACTCACCT ATTTGCATGTAAGTGAAAATAGG
Strand - +
Off-target summary No data {0: 1, 1: 3, 2: 47, 3: 154, 4: 561}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!