ID: 998323082_998323084 |
View in Genome Browser |
Spacer: 4 |
| Left Crispr | Right Crispr | |
|---|---|---|
| Crispr ID | 998323082 | 998323084 |
| Species | Human (GRCh38) | Human (GRCh38) |
| Location | 5:141250943-141250965 | 5:141250970-141250992 |
| Sequence | CCTCAATTTGCATTAACTCACCT | ATTTGCATGTAAGTGAAAATAGG |
| Strand | - | + |
| Off-target summary | No data | {0: 1, 1: 3, 2: 47, 3: 154, 4: 561} |
| Status | Not started | |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer | Left Crispr | Right Crispr | ||||||
|---|---|---|---|---|---|---|---|---|
| Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
| No off target data available for this pair! | ||||||||