ID: 998334076_998334082

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 998334076 998334082
Species Human (GRCh38) Human (GRCh38)
Location 5:141355428-141355450 5:141355445-141355467
Sequence CCTGAACCCGCGCAGCGGCACCT GCACCTTGGTCACCGCGGGTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 6, 4: 65} {0: 2, 1: 1, 2: 1, 3: 9, 4: 41}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!