ID: 998461738_998461748

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 998461738 998461748
Species Human (GRCh38) Human (GRCh38)
Location 5:142314859-142314881 5:142314897-142314919
Sequence CCTGGTCACAGCGGGCGGGCGTC GCCCCGCCCCGGGTCCGCTTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 56} {0: 1, 1: 0, 2: 1, 3: 23, 4: 137}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!