ID: 998596325_998596329

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 998596325 998596329
Species Human (GRCh38) Human (GRCh38)
Location 5:143534244-143534266 5:143534297-143534319
Sequence CCTCCATAATTCAATAAGCCATT TTTTATTGCTTCTGTTTCTCTGG
Strand - +
Off-target summary No data {0: 2, 1: 27, 2: 220, 3: 968, 4: 2496}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!